Primary accession number (String)
Bio::Sequence objects represent annotated sequences in bioruby. A Bio::Sequence object is a wrapper around the actual sequence, represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. For most users, this encapsulation will be completely transparent. Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA objects using the same arguments and returning the same values (even though these methods are not documented specifically for Bio::Sequence).
# Create a nucleic or amino acid sequence dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU') # Print it out puts dna.to_s puts aa.to_s # Get a subsequence, bioinformatics style (first nucleotide is '1') puts dna.subseq(2,6) # Get a subsequence, informatics style (first nucleotide is '0') puts dna[2,6] # Print in FASTA format puts dna.output(:fasta) # Print all codons dna.window_search(3,3) do |codon| puts codon end # Splice or otherwise mangle your sequence puts dna.splicing("complement(join(1..5,16..20))") puts rna.splicing("complement(join(1..5,16..20))") # Convert a sequence containing ambiguity codes into a # regular expression you can use for subsequent searching puts aa.to_re # These should speak for themselves puts dna.complement puts dna.composition puts dna.molecular_weight puts dna.translate puts dna.gc_percent
Organism classification, taxonomic classification of the source organism. (Array of String)
Data Class defined by EMBL (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_1
Taxonomic Division defined by EMBL/GenBank/DDBJ (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_2
Error probabilities of the bases/residues in the sequence. (Array containing Float, or nil)
Namespace of the sequence IDs described in entry_id, primary_accession, and secondary_accessions methods (String). For example, 'EMBL', 'GenBank', 'DDBJ', 'RefSeq'.
Sequence identifiers which are not described in entry_id, primary_accession,and secondary_accessions methods (Array of Bio::Sequence::DBLink objects). For example, NCBI GI number can be stored. Note that only identifiers of the entry itself should be stored. For database cross references, dblinks should be used.
The meaning (calculation method) of the quality scores stored in the quality_scores attribute. Maybe one of :phred, :solexa, or nil.
Note that if it is nil, and error_probabilities is empty, some methods implicitly assumes that it is :phred (PHRED score).
Quality scores of the bases/residues in the sequence. (Array containing Integer, or nil)
Strandedness (String). "single" (single-stranded), "double" (double-stranded), "mixed" (mixed-stranded), or nil.
Organism classification, taxonomic classification of the source organism. (Array of String)
Normally, users should not call this method directly. Use Bio::*to_biosequence (e.g. Bio::GenBank#to_biosequence).
Creates a new Bio::Sequence object from database data with an adapter module.
# File lib/bio/sequence.rb, line 463 def self.adapter(source_data, adapter_module) biosequence = self.new(nil) biosequence.instance_eval { remove_instance_variable(:@seq) @source_data = source_data } biosequence.extend(adapter_module) biosequence end
Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and return a new Bio::Sequence object wrapping a sequence of the guessed type (either Bio::Sequence::AA or Bio::Sequence::NA)
s = Bio::Sequence.auto('atgc') puts s.seq.class #=> Bio::Sequence::NA
Arguments:
(required) str: String or Bio::Sequence::NA/AA object
Returns |
Bio::Sequence object |
# File lib/bio/sequence.rb, line 283 def self.auto(str) seq = self.new(str) seq.auto return seq end
Guess the class of a given sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
puts .guess('atgc') #=> Bio::Sequence::NA
There are three optional parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
puts Bio::Sequence.guess('atgcatgcqq') #=> Bio::Sequence::AA puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
# limit the guess to the first 1000 positions puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000)
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start...
puts Bio::Sequence.guess('-----atgcc') #=> Bio::Sequence::AA puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
(required) str: String or Bio::Sequence::NA/AA object
(optional) threshold: Float in range 0,1 (default 0.9)
(optional) length: Fixnum (default 10000)
(optional) index: Fixnum (default 1)
Returns |
Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 381 def self.guess(str, *args) self.new(str).guess(*args) end
Create a new Bio::Sequence object from a formatted string (GenBank, EMBL, fasta format, etc.)
s = Bio::Sequence.input(str)
Arguments:
(required) str: string
(optional) format: format specification (class or nil)
Returns |
Bio::Sequence object |
# File lib/bio/sequence.rb, line 436 def self.input(str, format = nil) if format then klass = format else klass = Bio::FlatFile::AutoDetect.default.autodetect(str) end obj = klass.new(str) obj.to_biosequence end
Create a new Bio::Sequence object
s = Bio::Sequence.new('atgc') puts s #=> 'atgc'
Note that this method does not intialize the contained sequence as any kind of bioruby object, only as a simple string
puts s.seq.class #=> String
See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto for methods to transform the basic String of a just created Bio::Sequence object to a proper bioruby object
Arguments:
(required) str: String or Bio::Sequence::NA/AA object
Returns |
Bio::Sequence object |
# File lib/bio/sequence.rb, line 99 def initialize(str) @seq = str end
alias of Bio::Sequence.input
# File lib/bio/sequence.rb, line 447 def self.read(str, format = nil) input(str, format) end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('atgc') puts s.seq.class #=> String s.aa puts s.seq.class #=> Bio::Sequence::AA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('RRLE') s.aa
Returns |
# File lib/bio/sequence.rb, line 422 def aa @seq = AA.new(seq) @moltype = AA end
accession numbers of the sequence
Returns |
Array of String |
# File lib/bio/sequence.rb, line 454 def accessions [ primary_accession, secondary_accessions ].flatten.compact end
Guess the type of sequence, Amino Acid or Nucleic Acid, and create a new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis of this guess. This method will change the current Bio::Sequence object.
s = Bio::Sequence.new('atgc') puts s.seq.class #=> String s.auto puts s.seq.class #=> Bio::Sequence::NA
Returns |
Bio::Sequence::NA/AA object |
# File lib/bio/sequence.rb, line 264 def auto @moltype = guess if @moltype == NA @seq = NA.new(seq) else @seq = AA.new(seq) end end
Guess the class of the current sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
s = Bio::Sequence.new('atgc') puts s.guess #=> Bio::Sequence::NA
There are three parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
s = Bio::Sequence.new('atgcatgcqq') puts s.guess #=> Bio::Sequence::AA puts s.guess(0.8) #=> Bio::Sequence::AA puts s.guess(0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
s = Bio::Sequence.new(A VERY LONG SEQUENCE) puts s.guess(0.9, 1000) # limit the guess to the first 1000 positions
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start...
s = Bio::Sequence.new('-----atgcc') puts s.guess #=> Bio::Sequence::AA puts s.guess(0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
(optional) threshold: Float in range 0,1 (default 0.9)
(optional) length: Fixnum (default 10000)
(optional) index: Fixnum (default 1)
Returns |
Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 328 def guess(threshold = 0.9, length = 10000, index = 0) str = seq.to_s[index,length].to_s.extend Bio::Sequence::Common cmp = str.composition bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] + cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u'] total = str.length - cmp['N'] - cmp['n'] if bases.to_f / total > threshold return NA else return AA end end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('RRLE') puts s.seq.class #=> String s.na puts s.seq.class #=> Bio::Sequence::NA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('atgc') s.na
Returns |
# File lib/bio/sequence.rb, line 401 def na @seq = NA.new(seq) @moltype = NA end
Return sequence as String. The original sequence is unchanged.
seq = Bio::Sequence.new('atgc') puts s.to_s #=> 'atgc' puts s.to_s.class #=> String puts s #=> 'atgc' puts s.class #=> Bio::Sequence
Returns |
String object |
# File lib/bio/sequence/compat.rb, line 27 def to_s String.new(self.seq) end
Generated with the Darkfish Rdoc Generator 2.
Comments (String or an Array of String)